| Basic information from miRBase |
| hairpin accession number: MI0008634 |
| Located between position 85289172 and 85289242 on chromosome X strand - |
| Overlapping with sense strand of XM_521157.2 (intron 9). |
| (Ensemble: ENSPTRT00000041101) |
| mature miRNAs for MI0008634: |
| ptr-miR-361 (MIMAT0008115): TCCCCCAGGTGTGATTCTGATTT |
| You can find this miRNA in ENTREZGENE: MIR361 (accession: 100316415) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |