| Basic information from miRBase |
| hairpin accession number: MI0017297 |
| Located between position 35608084 and 35608162 on chromosome 9 strand + |
| Overlapping with sense strand of TESK1-005 (exon 2). |
| (Ensemble: OTTHUMT00000052318) |
| mature miRNAs for MI0017297: |
| hsa-miR-4667-5p (MIMAT0019743): ACTGGGGAGCAGAAGGAGAACC |
| hsa-miR-4667-3p (MIMAT0019744): TCCCTCCTTCTGTCCCCACAG |
| References |
| [1]Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C, Cancer Res. 71:78-86(2011)., "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" |