miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0000470

Located between position 17962557 and 17962645 on chromosome 21 strand +

Overlapping with sense strand of C21orf34-010 (intron 3).

(Ensemble: OTTHUMT00000158038)

mature miRNAs for MI0000470:

hsa-miR-125b (MIMAT0000423): TCCCTGAGACCCTAACTTGTGA

hsa-miR-125b-2* (MIMAT0004603): TCACAAGTCAGGCTCTTGGGAC

You can find this miRNA in TARGETS:PICTAR-VERT: hsa-miR-125b (accession: hsa-miR-125b)

References

[1]Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T, Curr Biol. 12:735-739(2002)., "Identification of tissue-specific microRNAs from mouse"

[2]Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR, Proc Natl Acad Sci U S A. 102:5570-5575(2005)., "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells"

[3]Lee YS, Kim HK, Chung S, Kim KS, Dutta A, J Biol Chem. 280:16635-16641(2005)., "Depletion of human micro-RNA miR-125b reveals that it is critical for the proliferation of differentiated cells but not for the down-regulation of putative targets during differentiation"

[4]Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X, FEBS Lett. 579:3849-3854(2005)., "Identification of human fetal liver miRNAs by a novel method"

[5]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"

[6]Lui WO, Pourmand N, Patterson BK, Fire A, Cancer Res. 67:6031-6043(2007)., "Patterns of known and novel small RNAs in human cervical cancer"

[7]Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V, BMC Genomics. 11 Suppl 1:S6(2010)., "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha"

PROMOTER INFORMATION

PROMOTER ID

LOCALIZATION

SEQUENCE

REFERENCE

SNP

TFBS

chr21, 16884078-16884427, +

promoter sequence

Zhou et al.