miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0002578
Located between position 16689195 and 16689283 on chromosome 21 strand +
Overlapping with sense strand of (intron 5).
(Ensemble: ENSPTRT00000060614)
mature miRNAs for MI0002578:
         ptr-miR-125b (MIMAT0002224): TCCCTGAGACCCTAACTTGTGA
You can find this miRNA in EMBL: AY865916 (accession: AY865916)

References
[1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes"