Basic information from miRBase |
hairpin accession number: MI0018000 |
Located between position 82300170 and 82300244 on chromosome 1 strand - |
mature miRNAs for MI0018000: |
ssc-miR-2476 (MIMAT0020599): TCCCTGTGGTCTAGTGGTTAG |
References |
[1]Li G, Li Y, Li X, Ning X, Li M, Yang G, J Cell Biochem. 112:1318-1328(2011)., "MicroRNA identity and abundance in developing swine adipose tissue as determined by solexa sequencing" |