| Basic information from miRBase |
| hairpin accession number: MI0012573 |
| Located between position 100161776 and 100161873 on chromosome 13 strand + |
| Overlapping with sense strand of (intron 5). |
| (Ensemble: ENSPTRT00000011009) |
| mature miRNAs for MI0012573: |
| ptr-miR-623 (MIMAT0012811): TCCCTTGCAGGGGCTGTTGGGT |
| You can find this miRNA in ENTREZGENE: MIR623 (accession: 100316297) |
| References |
| [1]Artzi S, Kiezun A, Shomron N, BMC Bioinformatics. 9:39(2008)., "miRNAminer: a tool for homologous microRNA gene search" |