| Basic information from miRBase |
| hairpin accession number: MI0008814 |
| Located between position 35513471 and 35513565 on chromosome 12 strand - |
| Overlapping with sense strand of XM_522410.2 (intron 1). |
| (Ensemble: ENSPTRT00000009261) |
| mature miRNAs for MI0008814: |
| ptr-miR-615 (MIMAT0008277): TCCGAGCCTGGGTCTCCCTCTT |
| You can find this miRNA in ENTREZGENE: MIR615 (accession: 100316531) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |