| Basic information from miRBase |
| hairpin accession number: MI0012811 |
| Located between position 2525731 and 2525797 on chromosome 14 strand + |
| Overlapping with sense strand of LOC100067162 (intron 1). |
| (Ensemble: ENSECAT00000007459) |
| mature miRNAs for MI0012811: |
| eca-miR-340-5p (MIMAT0013066): TTATAAAGCAATGAGACTGATT |
| eca-miR-340-3p (MIMAT0013067): TCCGTCTCAGTTACTTTATAGCC |
| You can find this miRNA in ENTREZGENE: MIR340 (accession: 100315065) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |