miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0012811
Located between position 2525731 and 2525797 on chromosome 14 strand +
Overlapping with sense strand of LOC100067162 (intron 1).
(Ensemble: ENSECAT00000007459)
mature miRNAs for MI0012811:
         eca-miR-340-5p (MIMAT0013066): TTATAAAGCAATGAGACTGATT
         eca-miR-340-3p (MIMAT0013067): TCCGTCTCAGTTACTTTATAGCC
You can find this miRNA in ENTREZGENE: MIR340 (accession: 100315065)

References
[1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach"