| Basic information from miRBase |
| hairpin accession number: MI0012931 |
| Located between position 3709569 and 3709634 on chromosome 27 strand + |
| Overlapping with sense strand of ANK1 (intron 40). |
| (Ensemble: ENSECAT00000016145) |
| mature miRNAs for MI0012931: |
| eca-miR-486-5p (MIMAT0013186): TCCTGTACTGAGCTGCCCCGAG |
| eca-miR-486-3p (MIMAT0013187): CGGGGCAGCTCAGTACAGGAT |
| You can find this miRNA in ENTREZGENE: MIR486 (accession: 100314927) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |