miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0018008
Located between position 60542165 and 60542228 on chromosome 11 strand +
Overlapping with sense strand of Smcr7-003 (intron 1).
(Ensemble: OTTMUST00000017732)
mature miRNAs for MI0018008:
         mmu-miR-5100 (MIMAT0020607): TCGAATCCCAGCGGTGCCTCT

References
[1]Spierings DC, McGoldrick D, Hamilton-Easton AM, Neale G, Murchison EP, Hannon GJ, Green DR, Withoff S, Blood. [Epub prior to print](2011)., "Ordered progression of stage specific miRNA profiles in the mouse B2 B cell lineage"