| Basic information from miRBase |
| hairpin accession number: MI0018008 |
| Located between position 60542165 and 60542228 on chromosome 11 strand + |
| Overlapping with sense strand of Smcr7-003 (intron 1). |
| (Ensemble: OTTMUST00000017732) |
| mature miRNAs for MI0018008: |
| mmu-miR-5100 (MIMAT0020607): TCGAATCCCAGCGGTGCCTCT |
| References |
| [1]Spierings DC, McGoldrick D, Hamilton-Easton AM, Neale G, Murchison EP, Hannon GJ, Green DR, Withoff S, Blood. [Epub prior to print](2011)., "Ordered progression of stage specific miRNA profiles in the mouse B2 B cell lineage" |