miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0011103
Located between position 889052 and 889171 on chromosome Crem_Contig20 strand -
mature miRNAs for MI0011103:
         crm-miR-59 (MIMAT0011606): TCGAATCGTTTATCAGGATGATG

References
[1]de Wit E, Linsen SE, Cuppen E, Berezikov E, Genome Res. 19:2064-2074(2009)., "Repertoire and evolution of miRNA genes in four divergent nematode species"