| Basic information from miRBase |
| hairpin accession number: MI0008011 |
| Located between position 38395124 and 38395179 on chromosome 13 strand - |
| Overlapping with sense strand of (intron 20). |
| (Ensemble: ENSCAFT00000001895) |
| mature miRNAs for MI0008011: |
| cfa-miR-151 (MIMAT0006615): TCGAGGAGCTCACAGTCTAGT |
| References |
| [1]Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N, Nat Biotechnol. 26:407-415(2008)., "Discovering microRNAs from deep sequencing data using miRDeep" |