| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0000351 |
| Located between position 3411992 and 3412086 on chromosome X strand + |
| Overlapping with antisense strand of C04F6.8 (exon 1). |
| (Ensemble: C04F6.8) WormBase: WormBase) |
| mature miRNAs for MI0000351: |
| cel-miR-271 (MIMAT0000327): TCGCCGGGTGGGAAAGCATT |
| References |
| [1]Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J, Mol Cell. 11:1253-1263(2003)., "Computational and experimental identification of C. elegans microRNAs" |
| more data |
| Data from CoGemiR |