miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0001824
Located between position 1559 and 1662 on chromosome AZM5_2488 strand -
mature miRNAs for MI0001824:
         zma-miR168a (MIMAT0001726): TCGCTTGGTGCAGATCGGGAC
         zma-miR168a* (MIMAT0015191): CCCGCCTTGCACCAAGTGAA

References
[1]Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA, Cell Res. 15:336-360(2005)., "Identification and characterization of new plant microRNAs using EST analysis"
[2]Dezulian T, Palatnik JF, Huson DH, Weigel D, http://genomebiology.com/2005/6/11/p13 (2005)., "Conservation and divergence of microRNA families in plants"
[3]Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D, PLoS Genet. 5:e1000716(2009)., "A genome-wide characterization of microRNA genes in maize"