miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0001482
Located between position 3380 and 3455 on chromosome AZM5_12831 strand +
mature miRNAs for MI0001482:
         zma-miR166h* (MIMAT0015148): GGAATGACGTCCGGTCCGAAC
         zma-miR166h (MIMAT0001377): TCGGACCAGGCTTCATTCCC

References
[1]Maher C, Timmermans M, Stein L, Ware D, Proc IEEE CSB :718-723(2004)., "Identifying microRNAs in plant genomes"
[2]Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D, PLoS Genet. 5:e1000716(2009)., "A genome-wide characterization of microRNA genes in maize"