| Basic information from miRBase |
| hairpin accession number: MI0014535 |
| mature miRNAs for MI0014535: |
| aly-miR166d* (MIMAT0017465): GGAATGTTGTCTGGCTCGAGG |
| aly-miR166d (MIMAT0017466): TCGGACCAGGCTTCATTCCCC |
| References |
| [1]Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC, Plant Cell. 22:1074-1089(2010)., "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" |
| [2]Ma Z, Coruh C, Axtell MJ, Plant Cell. 22:1090-1103(2010)., "Arabidopsis lyrata small RNAs: transient MIRNA and small interfering RNA loci within the Arabidopsis genus" |