| Basic information from miRBase |
| hairpin accession number: MI0008359 |
| Located between position 62860593 and 62860793 on chromosome SL2.40ch08 strand + |
| mature miRNAs for MI0008359: |
| sly-miR166b (MIMAT0007916): TCGGACCAGGCTTCATTCCCC |
| References |
| [1]Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T, Genome Res. 18:1602-1609(2008)., "Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening" |