miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008358
Located between position 2516284 and 2516394 on chromosome SL2.40ch06 strand -
mature miRNAs for MI0008358:
         sly-miR166a (MIMAT0007915): TCGGACCAGGCTTCATTCCCC

References
[1]Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T, Genome Res. 18:1602-1609(2008)., "Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening"