| Basic information from miRBase |
| hairpin accession number: MI0008132 |
| Located between position 72147671 and 72147730 on chromosome 8 strand + |
| Overlapping with antisense strand of XM_547983.2 (exon 1). |
| (Ensemble: ENSCAFT00000028454) |
| mature miRNAs for MI0008132: |
| cfa-miR-127 (MIMAT0006713): TCGGATCCGTCTGAGCTTGGCT |
| References |
| [1]Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N, Nat Biotechnol. 26:407-415(2008)., "Discovering microRNAs from deep sequencing data using miRDeep" |