miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0000154
Located between position 110831056 and 110831125 on chromosome 12 strand +
Overlapping with sense strand of Mir127-201 (exon 1).
(Ensemble: ENSMUST00000093568)
mature miRNAs for MI0000154:
         mmu-miR-127* (MIMAT0004530): CTGAAGCTCAGAGGGCTCTGAT
         mmu-miR-127 (MIMAT0000139): TCGGATCCGTCTGAGCTTGGCT
You can find this miRNA in EMBL: MMU459738 (accession: AJ459738)

References
[1]Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T, Curr Biol. 12:735-739(2002)., "Identification of tissue-specific microRNAs from mouse"
[2]Houbaviy HB, Murray MF, Sharp PA, Dev Cell. 5:351-358(2003)., "Embryonic stem cell-specific MicroRNAs"
[3]Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M, Nature. 432:226-230(2004)., "A pancreatic islet-specific microRNA regulates insulin secretion"
[4]Davis E, Caiment F, Tordoir X, Cavaille J, Ferguson-Smith A, Cockett N, Georges M, Charlier C, Curr Biol. 15:743-749(2005)., "RNAi-mediated allelic trans-interaction at the imprinted Rtl1/Peg11 locus"
[5]Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H, Genes Dev. 20:1732-1743(2006)., "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes"
[6]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[7]Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A, Mol Hum Reprod. 16:463-471(2010)., "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
[8]Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"


This microRNA is imprinted (based on ncRNAimprinted database)



more data
Expression data from PhenomiR