| Basic information from miRBase |
| hairpin accession number: MI0002583 |
| Located between position 101308238 and 101308334 on chromosome 14 strand + |
| Overlapping with antisense strand of XM_520846.2 (exon 1). |
| (Ensemble: ENSPTRT00000012391) |
| mature miRNAs for MI0002583: |
| ptr-miR-127 (MIMAT0002282): TCGGATCCGTCTGAGCTTGGCT |
| You can find this miRNA in EMBL: AY865921 (accession: AY865921) |
| References |
| [1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |