| Basic information from miRBase |
| hairpin accession number: MI0008437 |
| Located between position 144391366 and 144391438 on chromosome 8 strand - |
| Overlapping with sense strand of (intron 8). |
| (Ensemble: ENSPTRT00000038297) |
| mature miRNAs for MI0008437: |
| ptr-miR-1234 (MIMAT0007967): TCGGCCTGACCACCCACCCCAC |
| You can find this miRNA in ENTREZGENE: MIR1234 (accession: 100316365) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |