| Basic information from miRBase |
| hairpin accession number: MI0007497 |
| Located between position 16721831 and 16721921 on chromosome 9 strand - |
| Overlapping with sense strand of EIF4E2 (intron 6). |
| (Ensemble: ENSGALT00000012860) |
| mature miRNAs for MI0007497: |
| gga-miR-1755 (MIMAT0007662): TCGGTGAATGGCTTGGCATG |
| You can find this miRNA in ENTREZGENE: MIR1755 (accession: 100315893) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |