| Basic information from miRBase |
| hairpin accession number: MI0017762 |
| Located between position 2723038 and 2723140 on chromosome 2R strand - |
| Overlapping with antisense strand of CG15236-RA (3UTR 6). |
| (Ensemble: FBtr0086161) (FlyBase: FlyBase) |
| mature miRNAs for MI0017762: |
| dme-miR-4976-5p (MIMAT0020206): TCCAGGCTGTCGTCCATGGAGT |
| dme-miR-4976-3p (MIMAT0020207): TCGGTGGATGTCAGCCAGCG |
| References |
| [1]Berezikov E, Robine N, Samsonova A, Westholm JO, Naqvi A, Hung JH, Okamura K, Dai Q, Bortolamiol-Becet D, Martin R, Zhao Y, Zamore PD, Hannon GJ, Marra MA, Weng Z, Perrimon N, Lai EC, Genome Res. 21:203-215(2011)., "Deep annotation of Drosophila melanogaster microRNAs yields insights into their processing, modification, and emergence" |