miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008465
Located between position 136919747 and 136919830 on chromosome 9 strand +
Overlapping with sense strand of XM_001171777.1 (intron 7).
(Ensemble: ENSPTRT00000039962)
mature miRNAs for MI0008465:
         ptr-miR-126 (MIMAT0007985): TCGTACCGTGAGTAATAATGCG
You can find this miRNA in ENTREZGENE: MIR126 (accession: 100316068)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"