Basic information from miRBase |
hairpin accession number: MI0008465 |
Located between position 136919747 and 136919830 on chromosome 9 strand + |
Overlapping with sense strand of XM_001171777.1 (intron 7). |
(Ensemble: ENSPTRT00000039962) |
mature miRNAs for MI0008465: |
ptr-miR-126 (MIMAT0007985): TCGTACCGTGAGTAATAATGCG |
You can find this miRNA in ENTREZGENE: MIR126 (accession: 100316068) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |