| Basic information from miRBase |
| hairpin accession number: MI0008426 |
| Located between position 127406077 and 127406142 on chromosome 8 strand + |
| Overlapping with sense strand of XM_531153.2 (intron 1). |
| (Ensemble: ENSPTRT00000067910) |
| mature miRNAs for MI0008426: |
| ptr-miR-1204 (MIMAT0007958): TCGTGGCCTGGTCTCCATTAT |
| You can find this miRNA in ENTREZGENE: MIR1204 (accession: 100316425) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |