| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0001193 |
| Located between position 85892470 and 85892555 on chromosome 2 strand + |
| mature miRNAs for MI0001193: |
| gga-miR-187 (MIMAT0001124): TCGTGTCTTGTGTTGCAGCC |
| You can find this miRNA in ENTREZGENE: (accession: 777797) |
| References |
| [1]International Chicken Genome Sequencing Consortium, Nature. 432:695-716(2004)., "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" |
| [2]McBride D, Carre W, Law A, Clinton M, Unpublished., |
| more data |
| Data from CoGemiR |