miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008481
Located between position 40913930 and 40914029 on chromosome 15 strand -
Overlapping with antisense strand of XR_021969.1 (intron 2).
(Ensemble: ENSPTRT00000012927) RefSeq_dna: RefSeq)
mature miRNAs for MI0008481:
         ptr-miR-1282 (MIMAT0008001): TCGTTTGCCTTTTTCTGCTT
You can find this miRNA in ENTREZGENE: MIR1282-1 (accession: 100316076)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"