| Basic information from miRBase |
| hairpin accession number: MI0008481 |
| Located between position 40913930 and 40914029 on chromosome 15 strand - |
| Overlapping with antisense strand of XR_021969.1 (intron 2). |
| (Ensemble: ENSPTRT00000012927) RefSeq_dna: RefSeq) |
| mature miRNAs for MI0008481: |
| ptr-miR-1282 (MIMAT0008001): TCGTTTGCCTTTTTCTGCTT |
| You can find this miRNA in ENTREZGENE: MIR1282-1 (accession: 100316076) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |