| Basic information from miRBase |
| hairpin accession number: MI0008483 |
| Located between position 95983787 and 95983887 on chromosome 7 strand - |
| Overlapping with sense strand of XM_527824.2 (intron 1). |
| (Ensemble: ENSPTRT00000035945) |
| mature miRNAs for MI0008483: |
| ptr-miR-1282 (MIMAT0008001): TCGTTTGCCTTTTTCTGCTT |
| You can find this miRNA in ENTREZGENE: MIR1282-2 (accession: 100316369) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |