| Basic information from miRBase |
| hairpin accession number: MI0008484 |
| Located between position 59368048 and 59368133 on chromosome 19 strand + |
| mature miRNAs for MI0008484: |
| ptr-miR-1283 (MIMAT0008002): TCTACAAAGGAAAGCGCTTTCT |
| You can find this miRNA in ENTREZGENE: MIR1283 (accession: 100316519) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |