Basic information from miRBase |
hairpin accession number: MI0015577 |
Located between position 466718 and 466767 on chromosome scaffold_89 strand + |
Overlapping with sense strand of (intron 3). |
(Ensemble: ENSCINT00000002182) |
mature miRNAs for MI0015577: |
cin-miR-4026-5p (MIMAT0016542): GTAAGTGATGACGTCATTTG |
cin-miR-4026-3p (MIMAT0016543): TCTATGACGTCATTACTACG |
You can find this miRNA in ENTREZGENE: mir4026 (accession: 100499106) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" ![]() |