| Basic information from miRBase |
| hairpin accession number: MI0008629 |
| Located between position 100507619 and 100507716 on chromosome 14 strand + |
| Overlapping with sense strand of (intron 3). |
| (Ensemble: ENSPTRT00000012364) |
| mature miRNAs for MI0008629: |
| ptr-miR-342 (MIMAT0008110): TCTCACACAGAAATCGCACCCGT |
| You can find this miRNA in ENTREZGENE: MIR342 (accession: 100316146) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |