Basic information from miRBase |
hairpin accession number: MI0015963 |
Located between position 61302837 and 61302895 on chromosome Un strand + |
Overlapping with antisense strand of XM_548665.2 (exon 1). |
(Ensemble: ENSCAFT00000037518) |
mature miRNAs for MI0015963: |
cfa-miR-1837 (MIMAT0006630): TCTCAGAGGGACTGCGACATCT |
References |
[1]Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N, Nat Biotechnol. 26:407-415(2008)., "Discovering microRNAs from deep sequencing data using miRDeep" ![]() |