| Basic information from miRBase |
| hairpin accession number: MI0008550 |
| Located between position 55235683 and 55235765 on chromosome 19 strand - |
| mature miRNAs for MI0008550: |
| ptr-miR-150 (MIMAT0008044): TCTCCCAACCCTTGTACCAGTG |
| You can find this miRNA in ENTREZGENE: MIR150 (accession: 100316521) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |