| Basic information from miRBase |
| hairpin accession number: MI0012763 |
| Located between position 16156757 and 16156820 on chromosome 10 strand - |
| Overlapping with sense strand of (intron 4). |
| (Ensemble: ENSECAT00000019704) |
| mature miRNAs for MI0012763: |
| eca-miR-330 (MIMAT0013012): TCTCTGGGCCTGTGTCTTAGGC |
| You can find this miRNA in ENTREZGENE: MIR330 (accession: 100315056) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |