miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0011315
Located between position 85231999 and 85232077 on chromosome 12 strand +
Overlapping with sense strand of CDC16 (intron 8).
(Ensemble: ENSBTAT00000026604)
mature miRNAs for MI0011315:
         bta-miR-2303 (MIMAT0011814): TCTGAATGATGTCGACTGATG
You can find this miRNA in ENTREZGENE: MIR2303 (accession: 100313126)

References
[1]Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ, PLoS One. 4:e6349(2009)., "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection"