| Basic information from miRBase |
| hairpin accession number: MI0011315 |
| Located between position 85231999 and 85232077 on chromosome 12 strand + |
| Overlapping with sense strand of CDC16 (intron 8). |
| (Ensemble: ENSBTAT00000026604) |
| mature miRNAs for MI0011315: |
| bta-miR-2303 (MIMAT0011814): TCTGAATGATGTCGACTGATG |
| You can find this miRNA in ENTREZGENE: MIR2303 (accession: 100313126) |
| References |
| [1]Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ, PLoS One. 4:e6349(2009)., "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" |