| Basic information from miRBase |
| hairpin accession number: MI0008427 |
| Located between position 127573039 and 127573100 on chromosome 8 strand + |
| mature miRNAs for MI0008427: |
| ptr-miR-1205 (MIMAT0007959): TCTGCAGGGTTTGCTTTGAG |
| You can find this miRNA in ENTREZGENE: MIR1205 (accession: 100316048) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |