| Basic information from miRBase |
| hairpin accession number: MI0009941 |
| Located between position 35039886 and 35039959 on chromosome 19 strand + |
| Overlapping with sense strand of Kif20b-201 (intron 24). |
| (Ensemble: ENSMUST00000036256) |
| mature miRNAs for MI0009941: |
| mmu-miR-1950 (MIMAT0009417): TCTGCATCTAAGGATATGGTCA |
| You can find this miRNA in MGI: Mir1950 (accession: 3837023) |
| References |
| [1]Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK, Genome Res. 18:1787-1797(2008)., "In-depth characterization of the microRNA transcriptome in a leukemia progression model" |