miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0015147
Located between position 152525486 and 152525594 on chromosome X strand -
mature miRNAs for MI0015147:
         ppy-miR-767-5p (MIMAT0016107): TGCACCATGGTTGTCTGAGCATG
         ppy-miR-767-3p (MIMAT0016108): TCTGCTCATACCCCATGGTTTCT

References
[1]Brameier M, BMC Res Notes. 3:64(2010)., "Genome-wide comparative analysis of microRNAs in three non-human primates"