Basic information from miRBase |
hairpin accession number: MI0005866 |
Located between position 4343696 and 4343756 on chromosome 2L strand + |
Overlapping with sense strand of Atet-RA (intron 4). |
(Ensemble: FBtr0077426) (FlyBase: FlyBase) |
mature miRNAs for MI0005866: |
dme-miR-1005-3p (MIMAT0005018): TCTGGAATCTTTAATTCGCAG |
References |
[1]Ruby JG, Jan CH, Bartel DP, Nature. 448:83-86(2007)., "Intronic microRNA precursors that bypass Drosha processing" |
more data |
Data from CoGemiR |