| Basic information from miRBase |
| hairpin accession number: MI0008549 |
| Located between position 246867163 and 246867243 on chromosome 2b strand + |
| Overlapping with sense strand of (intron 1). |
| (Ensemble: ENSPTRT00000024305) |
| mature miRNAs for MI0008549: |
| ptr-miR-149 (MIMAT0008043): TCTGGCTCCGTGTCTTCACTCCC |
| You can find this miRNA in ENTREZGENE: MIR149 (accession: 100316539) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |