Basic information from miRBase |
hairpin accession number: MI0008549 |
Located between position 246867163 and 246867243 on chromosome 2b strand + |
Overlapping with sense strand of (intron 1). |
(Ensemble: ENSPTRT00000024305) |
mature miRNAs for MI0008549: |
ptr-miR-149 (MIMAT0008043): TCTGGCTCCGTGTCTTCACTCCC |
You can find this miRNA in ENTREZGENE: MIR149 (accession: 100316539) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" ![]() |