| PROMOTER INFORMATION | ||||||||||||||
| 540 | chr1, 117433788-117438873, + | promoter sequence | UCSC |  | | |||||||||
| Basic information from miRBase |
| hairpin accession number: MI0005767 |
| Located between position 117637265 and 117637350 on chromosome 1 strand + |
| Overlapping with sense strand of TTF2-003 (intron 1). |
| (Ensemble: OTTHUMT00000033314) |
| mature miRNAs for MI0005767: |
| hsa-miR-942 (MIMAT0004985): TCTTCTCTGTTTTGGCCATGTG |
| You can find this miRNA in HGNC: MIR942 (accession: 33688) |
| References | ||||||||||||||
| [1]Lui WO, Pourmand N, Patterson BK, Fire A, Cancer Res. 67:6031-6043(2007)., "Patterns of known and novel small RNAs in human cervical cancer" | ||||||||||||||
| PROMOTER INFORMATION | ||||||||||||||
| 540 | chr1, 117433788-117438873, + | promoter sequence | UCSC | | | |||||||||