| Basic information from miRBase |
| hairpin accession number: MI0008791 |
| Located between position 62000313 and 62000407 on chromosome 5 strand + |
| Overlapping with sense strand of XM_517765.2 (intron 5). |
| (Ensemble: ENSPTRT00000031285) |
| mature miRNAs for MI0008791: |
| ptr-miR-581 (MIMAT0008254): TCTTGTGTTCTCTAGATCAGT |
| You can find this miRNA in ENTREZGENE: MIR581 (accession: 100316233) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |