| Basic information from miRBase |
| hairpin accession number: MI0012720 |
| Located between position 41824838 and 41824916 on chromosome 5 strand + |
| Overlapping with antisense strand of (intron 15). |
| (Ensemble: ENSECAT00000028824) |
| mature miRNAs for MI0012720: |
| eca-miR-9a (MIMAT0012967): TCTTTGGTTATCTAGCTGTATGA |
| You can find this miRNA in ENTREZGENE: MIR9A (accession: 100314814) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |