| Basic information from miRBase |
| hairpin accession number: MI0008875 |
| Located between position 135630733 and 135630820 on chromosome 1 strand - |
| Overlapping with sense strand of (intron 2). |
| (Ensemble: ENSPTRT00000058684) |
| mature miRNAs for MI0008875: |
| ptr-miR-9 (MIMAT0002275): TCTTTGGTTATCTAGCTGTATGA |
| You can find this miRNA in ENTREZGENE: MIR9-1 (accession: 100316404) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |