| Basic information from miRBase |
| hairpin accession number: MI0011378 |
| Located between position 64559736 and 64559812 on chromosome 19 strand + |
| Overlapping with sense strand of KPCA_BOVIN (intron 3). |
| (Ensemble: ENSBTAT00000001407) |
| mature miRNAs for MI0011378: |
| bta-miR-2284p (MIMAT0011885): TGAAAGTTTGTTCGGGATTTT |
| You can find this miRNA in ENTREZGENE: MIR2284P (accession: 100313417) |
| References |
| [1]Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ, PLoS One. 4:e6349(2009)., "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" |