Basic information from miRBase |
hairpin accession number: MI0011579 |
Located between position 27336 and 27410 on chromosome 2LHet strand + |
Overlapping with antisense strand of CG12567-RA (intron 1). |
(Ensemble: FBtr0113704) (FlyBase: FlyBase) |
mature miRNAs for MI0011579: |
dme-miR-2490-5p (MIMAT0012197): TGAAGCGATAAAGCAGGTTGCAA |
dme-miR-2490-3p (MIMAT0020911): TGCTCTTACTTTATCGCTTAA |
References |
[1]Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC, Nat Genet. 42:6-9(2010)., "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" ![]() |