| Basic information from miRBase |
| hairpin accession number: MI0002235 |
| Located between position 3062198 and 3062286 on chromosome scaffold_2 strand - |
| mature miRNAs for MI0002235: |
| ptc-miR167a (MIMAT0001941): TGAAGCTGCCAGCATGATCTA |
| References |
| [1]Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm, Science. 313:1596-1604(2006)., "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" |