miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0006174
Located between position 358 and 465 on chromosome CK209908 strand +
mature miRNAs for MI0006174:
         tae-miR167 (MIMAT0005347): TGAAGCTGCCAGCATGATCTA

References
[1]Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK, Sun Q, Genome Biol. 8:R96(2007)., "Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)"