miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0015756
Located between position 1006638 and 1006691 on chromosome 2q strand -
Overlapping with sense strand of (intron 3).
(Ensemble: ENSCINT00000022363)
mature miRNAs for MI0015756:
         cin-miR-4199-3p (MIMAT0016818): TGAATTCGAAAAGGCCAAAC
You can find this miRNA in ENTREZGENE: mir4199 (accession: 100499004)

References
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data"