Basic information from miRBase |
hairpin accession number: MI0015756 |
Located between position 1006638 and 1006691 on chromosome 2q strand - |
Overlapping with sense strand of (intron 3). |
(Ensemble: ENSCINT00000022363) |
mature miRNAs for MI0015756: |
cin-miR-4199-3p (MIMAT0016818): TGAATTCGAAAAGGCCAAAC |
You can find this miRNA in ENTREZGENE: mir4199 (accession: 100499004) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" ![]() |